jueves, 10 de febrero de 2011

Preguntas de selectividad

Genética molecular

1.-¿Cómo se denomina el mecanismo que permite la duplicación de la información genética?. Explíquelo detalladamente.

El mecanismo que permite la duplicación de la información genética es la replicación.
Replicación, las cadenas del ADN duplicado son separadas por la acción de la helicasa que rompe los puentes de hidrógeno. La topoisomerasa elimina la tensión de las cadenas de ADN al estar enrolladas. La proteína SSB estabiliza la cadena sencilla para que no vuelva a enrollarse. Se produce unas zonas donde el ADN ueda separado, llamadas horquillas de replicación, que es donde comienza la síntesis (realizada por la ADN polimerasa III). En la horquilla de replicación hay una hebra que sintetiza de forma continua en sentido 3'→5', se llama hebra conductora, la otra hebra se sintetiza en varios fragmentos, llamados fragmentos de Okazaki, esta hebra sintetiza en sentido 5'←3' y es conocida como hebra retardada. La primasa (ARN polimerasa) sintetiza el primer (ARN cebador), ya que ella si puede comenzar una cadena y el ADN polimerasa no puede. El ADN polimerasa III alarga el primer sintetizado por la primasa. El ARN cebador es eliminado y el ADN polimerasa I rellena el hueco dejado por el ARN cebador. La ligasa une los fragmentos de Okazaki. Al finalizar el proceso se liberan dos moléculas idénticas de ADN, con una hebra antigua y otra nueva.

3.-Realice un esquema general de cómo se lleva a cabo la expresión genética, describiendo brevemente los procesos implicados en esta expresión y los pasos de que consta cada uno de ellos.

La expresióm genética se lleva a cabo a través del ADN que pasa a ARN por transcripción, luego el ARN pasa a proteína por traducción.
La transcripción consiste en la síntesis de un ARN complementario. Los ARN polimerasas se fijan a ciertas regiones promotoras del ADN. Desenrollan una vuelta de hélice y utiliza una cadena de ADN como molde para formar una cadena de ARn complementaria. Al avanzar desenrolla otra vuelta de hélice y la anterior se vuelve a enrollar, hasta que llega al final del gen donde se desprende la ARn polimerasa.
La traducción es el proceso de síntesis de proteínas a partir de la información aportada por el ARN mensajero. Consta de tres fases:
Iniciación, se coloca la subunidad 30s en los dos primeros dobletes, luego se coloca la subunidad 50s y ya está formado el complejo de iniciación.
Elongación, que a su vez consta de tres fases:
○Fijación, llega el segundo triplete y se coloca el codón ante el anticodón.
○Formación del enlace peptídico, la enzima peptidil transferasa transfiere la energía del enlace éster para formar el enlace peptídico entre los aminoácidos.
○Translocación, el ribosoma se desplaza un triplete en dirección 3'.
Terminación, se produce la hidrólisis del enlace éster, se libera la cadena peptídica y se separan las subunidades del ribosoma.

4.-En relación al esquema responda a las siguientes preguntas:
a) Nombre los procesos señalados con las letras A, B, C y D. Indique la composición de las moléculas incluidas en los recuadros.

A→transcripción inversa
B→traducción
C→duplicación
D→transcripción
ADN, está compuesto por un ácido ortofosfórico, una pentosa (desoxirribosa) y una base nitrogenada que puede ser adenina, guanina, citosina o timina.
ARN, está compuesto por un ácido ortofosfórico, una pentosa (ribosa) y una base nitrogenada que puede ser adenina, guanina, citosina o uracilo.
Proteína, está compuesta por la unión de aminoácidos que están unidos mediante un enlace peptídico.

b) Indique una función de cada una de las moléculas incluidas en los recuadros. Explique en qué consiste el proceso, ¿en qué formas biológicas se ha descrito el proceso A?

ADN, función, almacenar y transportar la información genética por la secuencia de aminoácidos.
ARN, función, sintetizar la proteína que contiene la información copiada del ADN.
Proteína, función enzimática, funciona como biocatalizador, controlando las reacciones metabólicas, es decir, disminuyendo la energía de activación de estas reacciones.
El proceso consiste en copiar la información del ADN y pasarlo a las proteínas. El proceso A se ha desscrito en virus y retrovirus.

7.-Defina los siguientes conceptos: replicación, transcripción y traducción. En qué parte  de las células procariotas y eucariotas tiene lugar estos procesos?. Describa cómo se lleva a cabo la transcripción.

Replicación, es el proceso por el cual el ADN se copia para poder ser transmitido a nuevos individuos.
Transcripción, es el proceso de copia de un gen o fragmento de ADN utilizando ribonucléotidos y originándose diferentes tipos de ARN.
Traducción, es el proceso de síntesis de proteínas llevado a cabo en los ribosomas, a partir de la información aportada por el ARN mensajero que es, a su vez, una copia de un gen.
En las células procariotas tiene lugar en el citoplasma y el las células eucariotas en el núcleo.
Transcripción, las ARN polimerasas se fijan a ciertas regiones promotoras del ADN, donde hay mucha timina y adenina. Desenrollan una vuelta de hélice y utiliza una cadena de ADN como molde para formar una cadena de ARN complementaria. Al avanzar desenrolla otra vuelta de hélice y la anterior se vuelve a enrollar. Los ribonucleótidos se añaden en sentido 5'←3', cuando se han unido los primeros 30 ribonucleótidos, se añade al extremo 5' una caperuza formada por 7-metilguanosina trifosfato. Esto se hace para que el ribosoma reconozca el comienzo del gen. La secuencia en el ADN (TTATTT) indica el final de la transcripción. A continuación, sobre el extremo 3' del ARN recién sintetizado se añaden unos 200 ribonucleótidos de adenina (cola poli-A) por acción de la enzima polimerasa. Se transcribe todos los exones e intrones. El ARN mensajero no puede ser traducido directamente, necesita maduración para eliminar los intrones. La maduración es realizada por las ribonucleoproteínas pequeñas nucleares (RNPpn). Los RNPpn  están formados de proteínas y de ARN, el ARN es complementario con las secuencias iniciales y finales de los intrones a los que se une cortándolos. La ligasa une a los exones y se obtiene el ARNm definitivo que se traduce en una proteína.

8.-Redacte un texto en el que se relacionen de forma coherente los siguientes términos: aminoácidos, poros nucleares, ARN mensajero, ARN transferente, ribosomas, código genético, ADN y proteínas.

La clave de la traducción reside en el código genético. El ARNt transporta su aminoácido hasta los ribosomas donde son ensamblados en el orden indicado por el ADN. El ARNm formado sobre el ADN del núcleo, sale a través de los poros nucleares de la membrana y llega al citoplasma donde se adhiere un ribosoma. en el ribosoma, el ARNm se traduce en una proteína.

9.-¿Cómo se puede explicar que una célula típica de nuestro cuerpo posea unas 10.000 clases diferentes de proteínas si el número de aminoácidos distintos es solamente 20?. Razone la respuesta.

Es posible ya que con los 20 aminoácidos se puede formar combinaciones con repetición de cuatro elevado al cubo, dando 64 combinaciones distintas que a su vez se pueden combinar y repetir hasta llegar a las diferentes clases de proteínas que existen en el cuerpo humano.

11.-En relación a la figura adjunta, responda a las siguientes preguntas:
a) ¿Cómo se denominan los dos procesos biológicos representados?. Identifique los distintos elementos de la figura señalados con números.

Se denominan transcripción y traduccción de la información genética.
El 1 es membrana del retículo endoplasmático rugoso, 2 ARN mensajero, 3 subunidad pequeña 40s, 4 subunidad grande 60s y 5 proteína

b) Identifique los extremos del elemento 2 (a y b) y los extremos de los elementos 5 (c y d). ¿Cuál es la composición química de los elementos señalados con los números 3 y 4?.

El elemento 2a es 5' de la cadena que es donde comienza la transcripción y el elemento 2b es 3' que tiene el poli A que se pega a la membrana a través de un receptor. El elemento 5c es el  grupo ácido de la proteína y el 5d es el grupo amino de la proteína.
Los elementos 3 y 4 están compuestos de varios ARN ribosómicos y de diferentes proteínas.

12.-Defina el proceso de traducción, indique dónde tiene lugar y describa cómo se realiza.

Traducción es el proceso de síntesis de proteínas llevado a cabo en los ribosomas, a partir de la información aportada por el ARN mensajero que es, a su vez, una copia de un gen.
La traducción tiene lugar en los ribosomas.
Traducción, consta de tres partes:
○Iniciación, la subunidad 30s del ribosoma se coloca en los dos primeros dobletes, el primero es AUG, codón  iniciación. El AUG es el codón correspondiente al anticodón UAC, que lleva el aminoácido llamado formil metionina. El formil metionina es un aminoácido metionina aminobloqueado para que el formilo no pueda formar enlace peptídico. Luego llega la subunidad 50s y se acopla. Varios factores de iniciación entran y salen del ribosoma y se hidroliza un GTP.
○Elongación, a su vez, está formada de tres fases:
-Fijación, llega el segundo triplete y se coloca el codón ante el anticodón. Dos factores de elongación y la hidrólisis permite la fijación.
-Formación del enlace peptídico, lo forma la enzima peptidil transferasa en la subunidad 50s. Transfiere la energía del enlace éster del ARNt aminocil para formar el enlace peptídico entre los aminoácidos.
-Translocación, para que ocurra la translocación tiene que llegar otro factor de elongación diferente al de fijación y la hidrólisis de GTP. El ribosoma se desplaza un triplete en dirección 3'. el aminoácido sale por degenerado. Hay dos sitios uno llamado P (peptidil) que tiene el ARNt con el péptido en formación y otro llamado A (aminoacil) que es donde se coloca el aminoacil ARNt. El proceso se repite, una nueva fijación en A, un enlace peptídico y otra translocación.
○Terminación, habría una cadena de formación hasta que la translocación se encuentra el anticodón de terminación, que puede ser UGA, UAA, UAG. este anticodón se encuentra bloqueado por factor de terminación. La P transfiere la energía del enlace éster al agua porque no hay ARNt. Se produce la hidrólisis del enlace éster. Se libera la cadena peptídica por la hidrólisis y se separan las subunidades del ribosoma.

13.-Las mutaciones generalmente son perniciosas para el individuo que las sufre, sin embargo desde el punto de vista evolutivo son muy importantes. Explique razonadamente esta aparente contradicción.

Desde el punto de vista evolutivo puede representar diversidad y cuando el organismo esta bajo condiciones adversas la mutación puede conferirle cierta ventaja ante los otros. Si esta mutación hace que la proteína trabaje más rápido o mejor este individuo sobrevive y se reproduce heredando su mutación a su progenie. Una colección de mutaciones en algún organismo podría representar una nueva especie.

14.-Si el código genético no fuese universal, ¿qué ocurriría al introducir el gen que codifica la insulina de ratón en una bacteria?. Razone la respuesta.

Si el código genético no fuese universal, no se produciría insulina en la bacteria ya que ese gen es específico del ratón y por lo tanto no sería traducido. Si por el contrario se produjese la insulina en la bacteria, ésta no sería funcional.

16.-Observe la figura adjunta y conteste:
a) ¿Cómo se llama el proceso representado en el esquema?. Identifique los elementos señalados con las letras A y B, indicando cuáles son sus principales semejanzas y diferencias.

El proceso representado en el esquema es una transcripción  de ADN a ARN.
El elemento A es ADN y el elemento B es ARN.
Sus semejanzas son: pertenecen a los ácidos nucleicos, son pentosas, tienen tres nucleótidos iguales, A, G y C. Sus diferencias: la pentosa del ADN contiene un oxígeno menos en el carbono 2, el ADN tiene timina y el ARN uracilo, el ADN es bicatenario y el ARN monocatenario, el ADN almacena la información genética y el ARN sintetiza las proteínas.

b) Indique la finalidad, dónde se realiza y describa las etapas del proceso que se representa. Indique qué significado en el esquema las anotaciones 5' y 3'.

Su finalidad es transmitir la información genética necesaria para la síntesis proteica. Se realiza en el núcleo de las células eucariotas y en el citoplasma de las células procariotas. Las etapas del proceso están respondidas en la pregunta 7.
Las anotaciones 5' y 3' indican los extremos de las cadenas, el 3' sería el principio y el 5' el final.

18.-Defina los siguientes conceptos: replicación, transcripción y traducción. ¿En qué parte de la célula procariota y eucariota tienen lugar estas funciones celulares?. Describa cómo se lleva a cabo la transcripción.

Respondido en la 7.

20.-Explique las funciones de los distintos ARN que intervienen en la síntesis de proteínas.

Las funciones de los distintos tipos de ARN son:
○ARNm, copia la información genética del ADN y lo transmite a los ribosomas.
○ARNr, lee el código genético del ARNm y fabrica la proteína expresada en ese gen.
○ARNt, transporta su aminoácido hasta los ribosomas donde son ensamblados en el orden indicado por el ARNm.

25.-Redacte un texto en el que se relacionen de forma coherente los siguientes términos: aminoácidos, poros nucleares, ARN, ribosomas y ADN.

Respondido en la pregunta 8.

27.-Explique qué es la regulación génica y por qué es necesaria. ¿Qué son los genes estructurales y los reguladores?.

La regulación génica es aquel proceso que afecta la acción del gen a nivel de transcripción o traducción, es necesaria para regular el funcionamiento de las proteínas.
Los genes estructurales son los que codifican las secuencias de aminoácidos de las proteínas estructurales y enzimáticas y los reguladores son los encargados de dirigir las sustancias represoras que se muestran en las actividades de los genes estructurales.

28.-Si se conociese la secuencia de aminoácidos de una proteína, ¿podría determinarse exactamente la secuencia de nucleótidos del ADN que la codifica?. ¿Ha aportado el descubrimiento del código genético alguna evidencia a favor de la teoría que considera que todos los seres vivos tienen un origen común?. Razone ambas respuestas.

No se podría determinar la secuencia de nucleótidos del ADN que la codifica ya que el código genético es degenerado, al estar compuesto por 64 codones, varios tripletes codifican para un mismo aminoácido y además por la maduración del ARNm, en el cual los codones tienen en común los dos primeros nucleótidos.
Sí, porque el código genético es universal, es decir, es igual  para todos los seres vivos, incluidos los virus, lo que determina que todos procedemos de un antecesor común.

29.-A la vista de la siguiente imagen, conteste:
a) Indique razonadamente de qué proceso se trata, ¿en qué lugar de la célula se produce?. ¿Cómo afectaría a este proceso una elevación brusca de la Tª por encima de los 80ºC?.

Se trata de la transcripción, que es donde se sintetiza una de las cadenas del ADN a ARN complementario. En células eucariotas se produce en el núcleo y en células procariotas se produce en el citoplasma.
Se produciría la desnaturalización del ADN y de las enzimas, con lo cual perdería su forma, es decir, su estado nativo, su función y sus propiedades, con lo cual no se llevaría a cabo la transcripción.

b) Explique la composición y estructura de la molécula resultante, ¿cuáles son las posibles funciones de esta molécula?.

La molécula resultante es un tipo de ARN puede ser: mensajero, ribosómico o transferente, los ARNs están formados por una pentosa (ribosa) y una base nitrogenada que puede ser adenina, guanina, citosina y uracilo. Su estructura es monocatenaria pero complementaria consigo misma formando puenetes de hidrógeno intracatenarios.
Funciones respondido en la pregunta 20.

30.-Explique el concepto de transcripción, indique dónde tiene lugar y cómo se realiza.

Respondido en la 7.

33.-Al hacer un análisis de la composición química del núcleo se ha detectado la presencia de muchas enzimas, aunque en él no existen ribosomas. Da una explicación razonada de este hecho. ¿Para qué son necesarias estas enzimas?. Razone la respuesta. 

Esto se debe a que cuando se realiza la traducción de ARNm a proteína los ribosomas se encuentran asociados a la membrana nuclear y la secuencia señal a través de un túnel pasa al núcleo.
Estas enzimas son necesarias para que se produzca la replicación de ADN, la transcripción y traducción del ARN y la regulación de las enzimas, es decir, para que permanezcan activas las enzimas precisas en cada momento, evitando la fabricación innecesaria de productos lo cual podría tener un efecto negativo en el organismo.

34.-Se presenta un fragmento de ADN; la flecha indica el sentido de lectura. Además se muestra el código genético. Conteste las siguientes cuestiones:
a) Indique la secuencia de bases del ARN mensajero transcrito y la secuencia de aminoácidos de la proteína sintetizada.

La secuencia de bases del ARN mensajero transcrito es: AUGCCCUCUAGUGGAGUAAUCCACUGGUAA
La secuencia de aminoácidos es:
MET-PRO-SER-SER-GLY-VAL-ILE-HIS-TRP-STOP

b) ¿Cómo se llaman los procesos implicados en el apartado anterior?. Si se conociese la secuencia de aminoácidos de una proteína, ¿se podría averiguar la secuencia de bases del ADN que la codifica?

Los procesos son transcripción y traducción.
Respondido en la pregunta 28.

35.-Explique qué se entiende por Código Genético. Explique los términos codón y anticodón. ¿Qué son los codones sin sentido o de terminación?. Explique dos características del Código Genético.

Se entiende por código genético al conjunto de normas por las que la información codificada en el material genético, secuencias de ARNm, se traduce en proteínas, secuencias de aminoácidos, en las células vivas.
Codón, es un grupo de 3 bases nitrogenadas de aminoácidos correspondientes.
Anticodón, es un grupo de 3 bases nitrogenadas que se encuentra en el ARNt y que es complementaria al codón ubicado en el ARNm.
Los codones sin sentido o de terminación son los que no corresponden a ningún aminoácido y nos indica el final de la cadena.
El código genético es universal y degenerado. Universal porque es igual para todos los seres vivos, incluidos los virus y degenerado porque un mismo aminoácido está determinado para varios codones, es decir, un mismo aminoácido se puede decir de varias formas ya que tiene en común dos bases nitrogenadas.

37.-La figura siguiente representa los resultados del experimento que Meselson y Stahl realizaron en relación con la replicación del ADN. Responda razonadamente las siguientes cuestiones:
a) Interprete esta experiencia a partir de sus conocimientos sobre la estructura del ADN y su mecanismo de replicación.

Este experimento se llevo a cabo para demostrar la hipótesis semiconservativa de la estructura del ADN. Cuando Watson y Crick elaboraron su modelo de doble hélice, también dedujeron que podía ser semiconservativa (una hebra de cada doble hélice procede de la original, mientras que la otra se sintetiza de nuevo) pero otros investigadores plantearon distintas hipótesis, como conservativa (la doble cadena original se mantiene y se sintetiza otra completamente nueva) y dispersiva (en cada doble hélice existen fragmentos de la original y fragmentos nuevos). 

b) ¿Cuál sería el aspecto de un quinto tubo de centrifugación obtenido a partir del cultivo sobre medio con N15 tres generaciones después de su transferencia al medio con N14?. ¿Qué aspecto tendría un sexto tubo de centrifugación obtenido a partir del cultivo sobre medio con N15 tras 100 generaciones después de su transferencia al medio con N14?.

En el quinto tubo de centrifugación aparecería una banda estrecha de ADN híbrido (con N15) y otra más ancha de ADN ligero (con N14).
En el sexto tubo aparecería una sola banda de ADN ligero, N14.

39.-La difteria está producida por la acción de la toxina de Corynebacterium diphteriae. La toxina impide la acción de la translocasa, enzima que favorece el movimiento del ARN mensajero en el ribosoma. El efecto de esta toxina puede matar a la célula. Explique razonadamente este hecho.

Al impedir la toxina la acción de la traslocasa no se produce el desplazamiento del ribosoma sobre el ARNm en sentido 5'→3' con lo cual el segundo codón con el ARNt fijado en el ribosoma no pasa al sitio P quedaría en el sitio A y no se podría formar un nuevo aminoacil ARNt con lo que llevaría a que el ARNt no pudiese realizar su función que es la de ensamblar  los ribosomas en el orden indicado en el ARNm que es el mismo que se encuentra en el gen del ADN, por lo tanto la toxina está ocasionando la detención de la síntesis proteica.

40.-Indique qué es la Replicación y describa el proceso. ¿Qué significa que la replicación es semiconservativa?

Respondido en la pregunta 1 y 7.
La replicación es semiconservativa significa que se obtienen dos moléculas de ADN hijas, formadas por una hebra original y otra hebra nueva.

42.-A la vista de la imagen, responda a las siguientes preguntas:
a) ¿Qué proceso se representa en el esquema?. Identifique las estructuras y las moléculas que aparecen en el dibujo.

El proceso que se representa en el esquema es la traducción.
En el dibujo aparecen: ribosoma, ARNm, ARNt y aminoácidos.

b) Explique cómo se lleva a cabo el proceso representado.

Respondido en la pregunta 12.

43.-Indique el significado de las siguientes afirmaciones y razone las repuestas:
Las dos hebras de una molécula de ADN son antiparalelas.

Significa que una hebra va en sentido 3'→5' y la otra va en sentido contrario para que puedan unirse entre sí, si fueran las dos en el mismo sentido no podrían unirse sus bases y por tanto la cadena no sería doble.

La replicación del ADN es semiconservativa.

Significa que se obtienen dos moléculas de ADN hijas, formadas por una hebra original y otra hebra nueva para que se pueda realizar la replicación del ADN.

La replicación del ADN es bidireccional.

Significa que la replicación del ADN se realiza en las dos cadenas, en una en sentido 3'→5' y en la otra en sentido 5'←3' porque la replicación empieza en el 3'.

Una de las cadenas del ADN se replica mediante fragmentos de Okazaki.

Significa que en una de las cadenas su síntesis es discontinua porque la hebra del ADN va en sentido 5'←3' y esto hace que sea más lenta porque tiene que unir los fragmentos de Okazaki. 

44.-La estreptomicina impide que el primer ARN transferente se una al ribosoma bacteriano. Explique razonadamente su efecto antibiótico.

Al impedir la estreptomicina la acción de la traslocasa no se produce el desplazamiento del ribosoma sobre el ARNm en sentido 5'→3' con lo cual el segundo codón con el ARNt fijado en el ribosoma no pasa al sitio P quedaría en el sitio A y no se podría formar un nuevo aminoacil ARNt con lo que llevaría a que el ARNt no pudiese realizar su función que es la de ensamblar  los ribosomas en el orden indicado en el ARNm que es el mismo que se encuentra en el gen del ADN, por lo tanto el antibiótico está ocasionando la detención de la síntesis proteica bacteriana.

46.-Indique la finalidad del proceso de replicación y en qué periodo del ciclo celular tiene lugar. Explique qué es un cebador y un fragmento de Okazaki y por qué es necesaria su presencia  en el proceso de replicación. Explique brevemente el proceso de replicación.

Su finalidad es copiar el ADN para que pueda ser transmitido a otros individuos. Tiene lugar en la fase S de la interfase del ciclo celular.
Un cebador es pequeño fragmento de ARN que sirve para iniciar la síntesis del ADN. Un fragmento de Okazaki es un fragmento de ADN por el que se va replicando la hebra retardada, a partir de la cadena 5'→3' del ADN molde. En el proceso de replicación es necesario un cebador porque las ADN polimerasa no saben comenzar una cadena y el cebador les ayuda.
El proceso de replicación está explicado en la pregunta 1.
  
47.-En relación con este esquema, responda a las siguientes preguntas:
a) ¿Cómo se denominan cada uno de los pasos indicados con flechas en el esquema y dónde se llevan a cabo en una célula eucariota?. Escriba que codones corresponden a cada uno de los 5 aminoácidos. Si una mutación puntual provoca que la primera base de la molécula 2 pase a ser una C en vez de una A, ¿qué cambio se origina en la secuencia de la molécula 3?.

El paso del esquema 1 al esquema 2 se denomina transcripción y en una célula eucariota se lleva a cabo en el núcleo. el paso del esquema 2 al esquema 3 se denomina traducción y en una célula eucariota se lleva a cabo en los ribosomas.
Ile→AUU, Arg→CGA, Cys→UGC, Val→GUC, Leu→CUU
Si la primera base de la molécula 2 fuera una C, se origina el codón CUU que codifica al amonoácido Leu.

b) Describa brevemente el proceso de síntesis de la molécula 3 e indique las fases de las que consta.

Explicado en la pregunta 12.

49.-Exponga razonadamente si el ADN de una célula de la piel de un individuo contendrá la misma información genética que una célula del hígado. ¿Sintetizan las dos células las mismas proteínas?. Razone las respuestas.

Sí, porque el ADN de un individuo se encuentra en todas sus células.
No, porque las proteínas de las células de la piel tienen función diferente a las proteínas que se encuentran en las células del hígado.

50.-Explique el concepto de gen y de genoma. ¿Qué es el código genético?. Explique qué significa que el código genético es universal y degenerado.

Gen, segmento de ADN que constituye la unidad hereditaria del ser vivo.
Genoma, es el conjunto de genes.
Respondido en la pregunta 35.

51.-¿Podrían los 20 aminoácidos estar codificados por un código genético constituido por dipletes de las cuatro bases nitrogenadas?. Razone la respuesta.

No, porque sólo se puede podrían formar 16 dipletes diferentes y hacen falta al menos 20 para poder codificar los 20 aminoácidos diferentes en las proteínas.

52.-Explique brevemente el proceso de replicación. Indique la finalidad de este proceso y el significado de la afirmación: "la replicación del ADN es semiconservativa".

Respondido en las preguntas 1 y 43.

56.-En relación a la figura adjunta sobre el flujo de la información genética, responda a las siguientes preguntas:
a) Nombre cada uno de los procesos biológicos que se indican con las letras a, b, c y d. Relacione cada uno de estos procesos con: ARN polimerasa dependiente de ADN, ribosomas, ADN polimerasa, anticodón, transcriptasa inversa, aminoácidos, ARN transferente y cebadores de ARN.

A→replicación
B→transcripción
C→ transcripción inversa
D→traducción
Replicación, ADN polimerasa, cebadores de ARN
Trancripción, ARN polimerasa dependiente de ADN
Transcripción inversa, transcriptasa inversa
Traducción, ribosomas, anticodón, aminoácidos, ARN transferente

b) Exponga la función de cada uno de estos procesos.

Replicación, su función es copiar el ADN para ser transmitido a nuevos individuos.
Transcripción, su función es copiar un gen para originar los distintos tipos de ARNs.
Transcripción inversa, su función es la síntesis del ADN de doble cadena del provirus.
Traducción, su función es determinar el orden en que se unirán los aminoácidos.

57.-a) Si un polipéptido tiene 450 aminoácidos, indique cuántos ribonucleótidos tendrá el fragmento del ARN mensajero que codifica esos aminoácidos.

Si cada aminoácido está constituido por 3 ribonucleótidos será 450 x 3 = 1350 ribonucleótidos.

b) Indique cuáles serán los anticodones de los ARN transferentes correspondientes a la molécula de ARNm 5'-GUU-UUC-GCA-UGG-3'.

CAA-AAG-CGU-ACC

c) Indique la secuencia de ADN que sirvió de molde para este mismo ARN mensajero.

3'-CAAAAGCGTACC-5'

58.-Explique cuál es la finalidad de la replicación y de la transcripción. Explique la traducción. Dibuje el inicio de la traducción.

Respondido en las preguntas 7 y 12.



59.-a) Complete la tabla que aparece a continuación que corresponde a las cadenas complementarias de un fragmento de ADN. Utilice las letras: P para el ácido fosfórico, D para la pentosa (2' desoxirribosa), A para adenina, C para citosina, G para guanina y T para timina. Indique, en cada caso, el número de puentes de hidrógeno que se establecen entre las dos bases nitrogenadas.

CADENA 1              Nº ENLACES               CADENA 2
P   D   A                             2                           T   D   P
P   D   C                             3                           G   D   P
P   D   C                             3                           G   D   P
P   D   A                             2                           T   D   P
 
b) Al finalizar las proporciones de bases nitrogenadas de un fragmento monocatenario de ADN humano los resultados fueron los siguientes: 27% de A, 35% de G, 25% de C y 13% de T. Indique cuáles serán las proporciones de bases de la cadena complementaria.

27% A→27% T
35% G→35% C
25% C→25% G
13% T→13% A

60.-En relación a la figura adjunta, conteste a las preguntas:
a) Nombre el tipo de molécula de que se trata. Cómo se denominan sus monómeros y cuál es su composición. Considerando la molécula en sentido longitudinal, las anotaciones 3' y 5' se sitúan en posiciones opuestas. Explique el significado de este hecho.

Se trata de una molécula de ADN.
Sus monómeros se denominan nucleótidos y se componen de un ácido ortofosfórico, una pentosa: desoxirribosa y una base nitrogenada que puede ser púrica (adenina o guanina) o pirimidínica (timina o citosina).
Las anotaciones 3' y 5' se sitúan en posiciones opuestas porque las cadenas son antiparalelas.

b) ¿Cómo se denomina el proceso por el cual esta molécula se duplica?. Explíquelo brevemente.

Respondido en la pregunta 1.

62.-¿Qué característica tiene el código genético  que permite que un gen de un organismo pueda expresarse en otro?. Razone la respuesta.

Respondido en la pregunta 35.

64.-En relación a la figura adjunta, responda a las siguientes preguntas:
a) ¿Qué tipo de molécula representa?. Explique su composición indicando el tipo de enlace que se produce entre sus componentes. ¿Cumple esta molécula la relación [purinas]/[pirimidinas]=1?.

Representa una molécula de ARN transferente.
Se compone de un ácido ortofosfórico, una pentosa: ribosa y una base nitrogenada que puede ser púrica (adenina o guanina) o pirimidínica (citosina o uracilo). La pentosa con la base nitrogenada se une mediante un enlace glucosílico y la pentosa con el ácido ortofosfórico mediante un enlace éster.
Esta molécula no cumple esa relación porque es una cadena monocatenaria, sólo cumple esa relación las cadenas bicatenarias como el ADN.

b) Explique su función indicando el nombre y la implicación en la misma de las regiones señaladas con los números 1 y 2.

Su función es la de almacenar y transportar la información genética por la secuencia de aminoácidos al ribosoma para la síntesis proteica. El número 1 es el brazo aceptor del aminoácido correspondiente al anticodón y el número 2 es el anticodón el cual hace el reconocimiento y la unión al triplete de nucleótidos del ARNm o codón.


65.-A un óvulo de una hembra A, se le elimina su núcleo y se le introduce el núcleo de una célula somática de un individuo B, y posteriormente se implanta en el útero de una hembra C. Si los individuos A, B y C son de la misma especie, ¿a quién se parecerán las características genéticas del individuo resultante?. Razone la respuesta.

Las características genéticas del individuo resultante se pareceran al individuo B porque el material genético se encuentra en el núcleo y el núcleo utilizado es del individuo B, ya que el individuo A solo aporta la célula y el individuo C solo aporta el útero.

66.-Explique qué se entiende por código genético. Defina los términos codón y anticodón. ¿Qué son los codones sin sentido o de terminación?. describa dos características del código genético.

Respondido en la pregunta 35.

68.-Cite y defina los dos procesos que tienen lugar en la expresión de la información genética. Indique si alguno de estos procesos podría darse en sentido inverso y en qué tipo de microorganismos se produce. Explique la función de los distintos tipos de ARN en la expresión génica.

Respondido en las preguntas 3 y 20.

69.-Indique si las afirmaciones siguientes son ciertas o falsas, razonando la respuesta:
a) Si en un ARNm se introduce un uracilo en la posición donde debería colocarse una citosina se produce una mutación.

Falsa, no se produciría una mutación, se produciría un cambio en la secuencia de aminoácidos.

b) En eucariotas el ARNm puede ser traducido nada más sintetizarse.

Falsa, este proceso sólo ocurre en procariotas, en eucariotas el ARN siempre necesita maduración por transcripción.

c) En una horquilla de replicación las dos hebras del ADN se replican en sentido 5'→3'.

Verdadera, las ADN polimerasas sintetizan en sentido 5'→3', una de las hebras sintetiza de forma continua, hebra conductora y la otra de forma discontinua, hebra retardada.

d) Si dos genes tienen secuencias de tripletes diferentes codificarán siempre cadenas peptídicas diferentes.

Falsa, al ser el código genético degenerado, varios tripletes diferentes pueden codificar el mismo aminoácido.

78.-Considere una célula en la que una determinada molécula de ADN de cadena doble presenta una proporción de Adenina del 30%. ¿Cuál será en dicha molécula la proporción de: T, G, C, bases púricas y bases pirimidínicas?. Indique si todas las moléculas de ADN de dicha célula presentan los mismos porcentajes de A, T, G, C, bases púricas y pirimidónicas. Razone la respuesta.

30% A→30% T
20% G→20% C
bases púricas→50%
bases pirimidínicas→50%
Todas las moléculas de ADN presentan el mismo porcentaje de bases púricas y bases piramidícas, es decir, el 50%, pero el porcentaje de A, T, G y C si serán distintos para cada molécula.

Enzimas:

1.-Al medir, a una determinada Tª y pH, la actividad de una reacción enzimática nos encontramos que durante la A, esta actividad vale 250 µmoles/min * mg proteína, mientras que durante la situación B vale el doble midiéndola a la misma Tª y pH. Explique las posibles razones que han podido ocasionar este cambio y justifique la respuesta.

Lo que ha podido ocasionar este cambio es la concentración de sustrato, al aumentar la concentración de sustrato existen más centros activos ocupados y la velocidad de la reacción aumenta hasta que no quedan centros activos libres, a partir de ese momento, un aumento de la concentración del sustrato no supone un aumento de la velocidad de la reacción. Si se disminuye la concentración de sustrato la velocidad a la que actúa la enzima se va reduciendo. 

2.-Describa el proceso de catálisis enzimática.

La catálisis enzimática consiste en rebajar la energía de activación (mínima energía necasaria para formar o romper enlaces), para llegar al estado de transición (estado en el que los enlaces de los reactivos están debilitados o rotos, pero aún no se han formado los nuevos), y permitir que la reacción se lleve a cabo. Cuando un sustrato se encuentra con la enzima correspondiente se produce la catálisis enzimática.
El sustrato se une a la apoenzima formando el complejo enzima-sustrato (ES), debido a su gran especificidad, para cada tipo de sustrato y de reacción existe una enzima concreta. La unión es reversible, ya que una parte del complejo enzima-sustrato se disocia, lo que hace que esta parte de la catálisis sea muy lenta. E+S↔ES. La unión de los radicales de los aminoácidos del centro activo al sustrato consigue debilitar sus enlaces, con lo cual se consigue alcanzar el estado de transición. Una vez formado el complejo enzima-sustrato el cofactor lleva a cabo la reacción y se obtiene el producto final (P). Esta parte de la catálisis es muy rápida e irreversible. ES→E+P. Si no existieran cofactores, la acción catalítica la realizan algunos aminoácidos del propio centro activo. El producto se libera del centro activo y la apoenzima queda libre para volver a unirse a nuevas moléculas de sustrato. La coenzima puede liberarse intacta o liberarse quedando modificada.

3.-Explique cuál es la función de las enzimas y qué se entiende por apoenzima, coenzima y centro activo.

La función de las enzimas es la de actuar como catalizador de las reacciones en los seres vivos.
Apoenzima, es la parte proteica de una enzima.
Coenzima, cofactor orgánico no proteico que unido a la apoenzima forma  la enzima.
Centro activo, es el lugar de la enzima que se adapta  al sustrato y actúa sobre él para originar el producto.

4.-A la vista de la gráfica, conteste a las siguientes cuestiones:
a) Explique qué representa la gráfica. Indique los valores aproximados de pH para los cuales dos enzimas tienen la misma velocidad de reacción. Para valores de la misma acidez, ¿cuál es el enzima con mayor actividad catalítica?

La gráfica representa el efecto del pH sobre la actividad enzimática, cada enzima tiene un pH óptimo de actuación, si el pH se encuentra por debajo del mínimo o por encima del máximo se produce la desnaturalización de la enzima y por tanto su actividad catalítica se anulará por completo.
La fosfatasa y la papaína tienen la misma velocidad de reacción en pH 6 aproximadamente y pH 11 aproximadamente.
La enzima con mayor actividad catalítica es la pepsina.

b) Si el pH de la sangre fuera 7.5, indique qué enzimas podrían presentar actividad catalítica en el plasma sanguíneo. Explique el comportamiento de cada enzima en función del pH.

Las enzimas que podrían presentar actividad catalítica en el plasma sanguíneo son la fosfatasa y papaína.
La enzima pepsina tiene un pH entre 0 y 7, lo cual hace que funcione mejor en medios ácidos.
La enzima fosfata tiene un pH entre 5 y 11, lo que hace que funcione mejor en medios básicos.
La enzima papaína tiene un pH entre 0 y 11, lo que hace que funcione en medios ácidos y medios básicos.

5.-A la vista de la gráfica, conteste:
a) Explique qué representa esta gráfica. ¿Por qué la velocidad de la reacción aumenta al principio de la curva, al aumentar la concentración de sustrato?

Esta gráfica representa la velocidad de reacción necesaria para cada concentración de sustrato.
Porque a mayor número de moléculas de sustrato, más moléculas de producto aparecerán y por tanto la velocidad aumenta.

b) ¿Por qué la velocidad permanece prácticamente constante a partir de una determinada concentración de sustrato?. ¿Qué ocurrirá si se aumenta la concentración de enzimas?

Porque aunque siga aumentando la concentración de sustrato llega un momento en que todas las enzimas libres están ocupadas por moléculas de sustrato formando complejos ES y la velocidad no varía.
Si se aumenta la concentración de enzimas la velocidad aumentará proporcionalmente a lo largo de toda la curva.

6.-Al hacer un análisis de la composición química del núcleo se ha detectado la presencia de enzimas, aunque en él no existen ribosomas. Da una explicación razonada de este hecho. ¿Para qué son necesarias estas enzimas?. Razone la respuesta.

Esto se debe a que cuando se realiza la traducción de ARNm a proteína los ribosomas se encuentran asociados a la membrana nuclear y la secuencia señal a través de un túnel pasa al núcleo.
Estas enzimas son necesarias para que se produzca la replicación de ADN, la transcripción y traducción del ARN y la regulación de las enzimas, es decir, para que permanezcan activas las enzimas precisas en cada momento, evitando la fabricación innecesaria de productos lo cual podría tener un efecto negativo en el organismo.


7.-La difteria está producida por la acción de la toxina Corynebacterium difteriae. La toxina impide la acción de la traslocasa, enzima que favorece el movimiento del ARN mensajero en el ribosoma. El efecto de esta toxina puede matar a la célula. Explique razonadamente este hecho.

Al impedir la toxina la acción de la traslocasa no se produce el desplazamiento del ribosoma sobre el ARNm en sentido 5'→3' con lo cual el segundo codón con el ARNt fijado en el ribosoma no pasa al sitio P quedaría en el sitio A y no se podría formar un nuevo aminoacil ARNt con lo que llevaría a que el ARNt no pudiese realizar su función que es la de ensamblar  los ribosomas en el orden indicado en el ARNm que es el mismo que se encuentra en el gen del ADN.

8.-Enumere tres factores que influyan en la actividad enzimática. Explique detalladamente el efecto de dos de ellos.

En la actividad enzimática influye la concentración del sustrato, el pH y la temperatura.
PH, cada enzima tiene un pH óptimo de actuación, los valores de pH por debajo o por encima del pH óptimo provoca un descenso de la velocidad enzimática que puede provocar la desnaturalización de la enzima y por tanto su actividad queda anulada por completo.
Temperatura, cada enzima tiene una temperatura óptima de actuación, si la temperatura esta por debajo de la óptima se produce una disminución de la energía de activación haciendo que el proceso sea más lento y si la temperatura esta por encima de la óptima se produce la desnaturalización de la enzima y pierde su funcionalidad.

9.-En una reacción química en la que la sustancia A se transforma en B, se liberan 10 kcal/mol de sustrato. ¿Cuánta energía se liberaría si la reacción estuviese catalizada por un enzima?. Razone la respuesta.

La energía sería la misma, ya que la variación de energía de una reacción es independiente de la presencia de un catalizador. El catalizador únicamente ayuda a que se produzca la reacción.

10.-En un ensayo enzimático, se produjo, accidentalmente, una elevación brusca de la Tª y se detuvo la actividad enzimática. Al bajar la temperatura se recuperó la actividad enzimática. Explique razonadamente este hecho.

Cada enzima tiene una temperatura óptima de actuación si esta por encima de la óptima se produce la desnaturalización y por tanto la enzima pierde su funcionalidad, pero si vuelve a bajar hasta su temperatura óptima, la enzima se renaturaliza y vuelve a recuperar su actividad enzimática.

11.-Al investigar el efecto de la Tª sobre la velocidad de una reacción enzimática se obtuvo la siguiente tabla: Proponga una explicación razonada de los resultados en la misma.

La enzima que actua en esta reacción enzimática tiene una temperatura óptima de 40ºC, si disminuye la temperatura se produce una disminución de la energía de activación haciendo que el proceso sea más lento y si se sube la temperatura se produce la desnaturalización de la enzima y pierde su funcionalidad que en esta tabla esta en los 60ºC.

12.-Defina: enzima, centro activo, coenzima, inhibidor y energía de activación.

Enzima, molécula formada por proteínas que producen las células vivas y que actúa como catalizador y regulador en los procesos químicos del organismo.
Centro activo,es el lugar de la enzima que se adapta  al sustrato y actúa sobre él para originar el producto.
Coenzima, cofactor orgánico no proteico que unido a la apoenzima forma  la enzima.
Inhibidor, sustancia que disminuye o anula la actividad de una enzima.
Energía de activación, es la mínima energía necesaria para formar o romper enlaces, es decir, la mínima energía necesaria para convertir un mol de sustrato en un mol de producto.

13.-Explique razonadamente cómo afectan la Tª, el pH y la concentración de sustrato a la actividad de las enzimas. Describa dos tipos de inhibición enzimática.

PH, cada enzima tiene un pH óptimo de actuación, los valores de pH por debajo o por encima del pH óptimo provoca un descenso de la velocidad enzimática que puede provocar la desnaturalización de la enzima y por tanto su actividad queda anulada por completo.
Temperatura, cada enzima tiene una temperatura óptima de actuación, si la temperatura esta por debajo de la óptima se produce una disminución de la energía de activación haciendo que el proceso sea más lento y si la temperatura esta por encima de la óptima se produce la desnaturalización de la enzima y pierde su funcionalidad.
Concentración de sustrato, al aumentar la concentración de sustrato existen más centros activos ocupados y la velocidad de la reacción aumenta hasta que no quedan centros activos libres, a partir de ese momento, un aumento de la concentración del sustrato no supone un aumento de la velocidad de la reacción. Si se disminuye la concentración de sustrato la velocidad a la que actúa la enzima se va reduciendo. 
Inhibición enzimática:
Inhibición competitiva, el inhibidor se une al centro activo impidiendo la unión del sustrato. Existe una competencia entre ambos para ocupar el centro activo. Si este es ocupado por el sustrato, la reacción se lleva a cabo, pero si es ocupado por el inhibidor no se produce, ya que el sustrato no puede acoplarse.
Inhibición no competitiva, el inhibidor no compite con el sustrato, sino que se une en otra zona de la enzima distinta del centro activo. Esta unión modifica la estructura de la enzima al tiempo que dificulta el acoplamiento del sustrato.

14.-El colágeno es una proteína de aspecto blanquecino que forma parte de las estructuras resistentes como los tendones. Al hervir el colageno se obtiene gelatina que es una sustancia muy blanda. Explique razonadamente la causa de este cambio.

El cambio se debe a la desnaturalización de la proteína, es decir, las proteínas pierden su estructura tridimensional y con ello su actividad biológica. Esto ocurre por distintos factores, como son la temperatura, el pH o la presencia de ciertos iones. La desnaturalización afecta a las estructuras cuaternaria, terciaria y secundaria.

15.-La polifenoloxidasa es una enzima capaz de oxidar los polifenoles en presencia de oxígeno y así es responsable del pardeamiento (oscurecimiento) que sufren los frutos, como la manzana, a los pocos minutos de haberlos cortado. Este pardeamiento se puede evitar reduciendo el acceso del enzima al sustrato, en este caso el oxígeno, o añadiendo compuestos ácidos, o calentando durante cinco minutos en agua hirviendo. Explique razonadamente por qué se produce el pardeamiento en estos tres casos.

El pardeamiento de estos casos se produce por estos tres factores que influyen en la actividad enzimática:
○PH, cada enzima tiene un pH óptimo de actuación, los valores de pH por debajo o por encima del pH óptimo provoca un descenso de la velocidad enzimática que puede provocar la desnaturalización de la enzima y por tanto su actividad queda anulada por completo.
○Temperatura, cada enzima tiene una temperatura óptima de actuación, si la temperatura esta por debajo de la óptima se produce una disminución de la energía de activación haciendo que el proceso sea más lento y si la temperatura esta por encima de la óptima se produce la desnaturalización de la enzima y pierde su funcionalidad.
○Concentración de sustrato, al aumentar la concentración de sustrato existen más centros activos ocupados y la velocidad de la reacción aumenta hasta que no quedan centros activos libres, a partir de ese momento, un aumento de la concentración del sustrato no supone un aumento de la velocidad de la reacción. Si se disminuye la concentración de sustrato la velocidad a la que actúa la enzima se va reduciendo. 

4 comentarios:

  1. Deberías añadir al texto las imágenes de las cuestiones y cualquiera otra que ilustrase tus respuestas, videos, links .... herramientas que el blog te permite. Como has hecho con lo demás.

    ResponderEliminar
    Respuestas
    1. Hola, estudio selectividad y tu blog me sirve de mucha ayuda, creo que tu profesor es un poco estúpido, porque con el poco tiempo libre que hay en segundo bachiller te debió costar mucho esfuerzo hacer tantos ejercicios. Creo que pide demasiado, cuando quita a sus alumnos tiempo de estudiar otras asignaturas. UN SALUDO

      Eliminar
  2. Tu blog es genial me ha servido de mucho, pero creo igual que deberías añadir imágenes a los ejercicios, sino no tienen sentido. Gracias y enhorabuena.

    ResponderEliminar
  3. ¿Podrías ayudarme en un ejercicio de selectividad del año 2004? No encuentro la solución por ninguna parte. Es sobre una imagen y solo tengo duda en el apartado a que dice asi: ¿qué proceso representa la figura?. Identifique las macromoléculas señaladas con números romanos.En http://www.joaquinrodriguezpiaya.es/2BachilleratoBiologia/Practicas/selectividad/selectividad_genetica_molecular.pdf en la página 7 viene el ejercicio con la imagen pero no viene resuelto. Es el primer ejercicio de la hoja. Te agradecería mucho que me ayudaras. Gracias.

    ResponderEliminar